c-Myc (MYC) Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro

Product Name:	c-Myc (MYC) Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro
CAT#:	GKKC -2312-HMS-9
Size:	1 Kit
Datasheet

Description

MYC - KN2.0, human gene knockout kit via CRISPR, non-homology mediated.

Product Data

Format:	2 gRNA vectors, 1 linear donor
Donor DNA:	EF1a-GFP-P2A-Puro
Symbol:	c-Myc
Locus ID:	4609
Components:	c-Myc gRNA vector 1, Target Sequence: GCTGCACCGAGTCGTAGTCG c-Myc gRNA vector 2, Target Sequence: GCTCGCTCTGCTGCTGCTGC Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP
RefSeq:	NM_002467, NM_001354870
UniProt ID:	P01106
Synonyms:	bHLHe39, c-Myc, MRTL, MYCC

Disclaimer

Protheragen manufactures and supplies these products with a license from ERS. The kits have been developed using the most advanced understanding of CRISPR technology. The system has been tested and confirmed to successfully insert gene cassettes downstream of the natural promoter. The effectiveness of gene knockdown may vary due to the specific biological factors and the complexity of the experimental process.

All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.