Epoxide hydrolase (EPHX1) Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro

Product Name:	Epoxide hydrolase (EPHX1) Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro
CAT#:	GKKC -2312-HMS-10
Size:	1 Kit
Datasheet

Description

EPHX1 - KN2.0, human gene knockout kit via CRISPR, non-homology mediated.

Product Data

Format:	2 gRNA vectors, 1 linear donor
Donor DNA:	EF1a-GFP-P2A-Puro
Symbol:	Epoxide hydrolase
Locus ID:	2052
Components:	Epoxide hydrolase gRNA vector 1, Target Sequence: GAGGGTGGTGTGTCGAAGAC Epoxide hydrolase gRNA vector 2, Target Sequence: CGACAGCATCCGCCCTTTCA Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP
RefSeq:	NM_000120, NM_001136018, NM_001291163
UniProt ID:	P07099
Synonyms:	EPHX, EPOX, HYL1, MEH

Disclaimer

Protheragen manufactures and supplies these products with a license from ERS. The kits have been developed using the most advanced understanding of CRISPR technology. The system has been tested and confirmed to successfully insert gene cassettes downstream of the natural promoter. The effectiveness of gene knockdown may vary due to the specific biological factors and the complexity of the experimental process.

All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.