Online Inquiry
Inquiry
FOXM1 Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro
Product Name: | FOXM1 Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro |
CAT#: | GKKC -2312-HMS-7 |
Size: | 1 Kit |
Datasheet |
Description
FOXM1 - KN2.0, human gene knockout kit via CRISPR, non-homology mediated.
Product Data
Format: | 2 gRNA vectors, 1 linear donor |
Donor DNA: | EF1a-GFP-P2A-Puro |
Symbol: | FOXM1 |
Locus ID: | 2305 |
Components: | FOXM1 gRNA vector 1, Target Sequence: TTGAGAATCAGTGGCCGACG FOXM1 gRNA vector 2, Target Sequence: TGGGGCATTTTGAACAGGAA Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP |
RefSeq: | NM_001243088, NM_001243089, NM_021953, NM_202002, NM_202003 |
UniProt ID: | Q08050 |
Synonyms: | FKHL16, FOXM1B, HFH-11, HFH11, HNF-3, INS-1, MPHOSPH2, MPP-2, MPP2, PIG29, TGT3, TRIDENT |
Disclaimer
Protheragen manufactures and supplies these products with a license from ERS. The kits have been developed using the most advanced understanding of CRISPR technology. The system has been tested and confirmed to successfully insert gene cassettes downstream of the natural promoter. The effectiveness of gene knockdown may vary due to the specific biological factors and the complexity of the experimental process. |
All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.