Solutions
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Inquiry

Her2 (ERBB2) Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro

Product Name: Her2 (ERBB2) Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro
CAT#: GKKC -2312-HMS-4
Size: 1 Kit
Datasheet
Her2 (ERBB2) Human Gene Knockout Kit (CRISPR), EF1a-GFP-P2A-Puro.png

Description

ERBB2 - KN2.0, human gene knockout kit via CRISPR, non-homology mediated.

Product Data

Format: 2 gRNA vectors, 1 linear donor
Donor DNA: EF1a-GFP-P2A-Puro
Symbol: Her2
Locus ID: 2064
Components: Her2 gRNA vector 1, Target Sequence: TGCCAGTCCCGAGACCCACC
Her2 gRNA vector 2, Target Sequence: AGAGGTGGCGGAGCATGTCC
Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP
RefSeq: NM_001005862, NM_001289936, NM_001289937, NM_001289938, NM_004448, NR_110535
UniProt ID: P04626
Synonyms: CD340, HER-2, HER-2/neu, HER2, MLN 19, NEU, NGL, TKR1

Disclaimer

Protheragen manufactures and supplies these products with a license from ERS. The kits have been developed using the most advanced understanding of CRISPR technology. The system has been tested and confirmed to successfully insert gene cassettes downstream of the natural promoter. The effectiveness of gene knockdown may vary due to the specific biological factors and the complexity of the experimental process.

All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.

Copyright © Protheragen. All rights reserves.