Human Alpha 1 Antitrypsin (SERPINA1) Activation Kit

Product Name:	Human Alpha 1 Antitrypsin (SERPINA1) Activation Kit
CAT#:	GCK-2312-HMS-6
Size:	1 Kit
Datasheet

Description

SERPINA1 CRISPRa kit - CRISPR gene activation of human serpin family A member 1

Product Data

Format:	=K6
Symbol:	SERPINA1
Locus ID:	5265
Components:	alpha 1 Antitrypsin gRNA vector 1, Target Sequence: CTTCCTGGGTGGGCAGGAAC alpha 1 Antitrypsin gRNA vector 2, Target Sequence: GTGGAGGCAGTGCATGCCCT alpha 1 Antitrypsin gRNA vector 3, Target Sequence: AGACTTCGGGTGGAGGCAGT 1 CRISPRa-Enhancer vector 1 CRISPRa scramble vector
RefSeq:	NM_000295, NM_001002235, NM_001002236, NM_001127700, NM_001127701, NM_001127702, NM_001127703, NM_001127704, NM_001127705, NM_001127706, NM_001127707
UniProt ID:	P01009
Synonyms:	A1A, PI, A1AT, AAT, alpha1AT, PI1, PRO2275

Disclaimer

Our company designed CRISPRa kits utilizing advanced CRISPRa SAM technology. The effectiveness of the activation may be influenced by various factors, such as nucleosome occupancy status, chromatin structure, and the expression level of the target gene, among others.

All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.