Online Inquiry
Inquiry
 activation kit by CRISPRa.png)
Human Androgen Receptor (AR) Activation Kit
| Product Name: | Human Androgen Receptor (AR) Activation Kit |
| CAT#: | GCK-2312-HMS-1 |
| Size: | 1 Kit |
| Datasheet |
Description
AR CRISPRa kit - CRISPR gene activation of human androgen receptor
Product Data
| Format: | Three gRNAs (15 μg total, 5 μg each), one scramble control (10 μg) and one enhancer vector (10 μg) |
| Symbol: | AR |
| Locus ID: | 367 |
| Components: | Androgen Receptor gRNA vector 1, Target Sequence: AATGCAACAGTTTGCGAGTC Androgen Receptor gRNA vector 2, Target Sequence: GAGGGGAGGGAAAAGGAGGT Androgen Receptor gRNA vector 3, Target Sequence: AGGTGGGAAGGCAAGGAGGC 1 CRISPRa-Enhancer vector 1 CRISPRa scramble vector |
| RefSeq: | NM_000044, NM_001011645, NM_001348061, NM_001348063, NM_001348064 |
| UniProt ID: | P10275 |
| Synonyms: | AIS, HYSP1, SBMA, AR8, DHTR, SMAX1, HUMARA, KD, NR3C4, TFM |
Disclaimer
| Our company designed CRISPRa kits utilizing advanced CRISPRa SAM technology. The effectiveness of the activation may be influenced by various factors, such as nucleosome occupancy status, chromatin structure, and the expression level of the target gene, among others. |
All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.
