Online Inquiry
Inquiry
Human OTX2 Activation Kit
 activation kit by CRISPRa.png)
Description
OTX2 CRISPRa kit - CRISPR gene activation of human orthodenticle homeobox 2
Product Data
| Format: | =K8 |
| Symbol: | OTX2 |
| Locus ID: | 5015 |
| Components: | OTX2 gRNA vector 1, Target Sequence: TACAATTAGTTCACATGCTC OTX2 gRNA vector 2, Target Sequence: GATTGACACATCTAAGCCAG OTX2 gRNA vector 3, Target Sequence: GCGTCAAAAAGTTGCCAGAG 1 CRISPRa-Enhancer vector 1 CRISPRa scramble vector |
| RefSeq: | NM_001270523, NM_001270524, NM_001270525, NM_021728, NM_172337, NR_073034, NR_073036 |
| UniProt ID: | P32243 |
| Synonyms: | CPHD6, MCOPS5 |
Disclaimer
| Our company designed CRISPRa kits utilizing advanced CRISPRa SAM technology. The effectiveness of the activation may be influenced by various factors, such as nucleosome occupancy status, chromatin structure, and the expression level of the target gene, among others. |
All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.
