Human Oxytocin Neurophysin 1 (OXT) Activation Kit

Product Name:	Human Oxytocin Neurophysin 1 (OXT) Activation Kit
CAT#:	GCK-2312-HMS-9
Size:	1 Kit
Datasheet

Description

OXT CRISPRa kit - CRISPR gene activation of human oxytocin/neurophysin I prepropeptide

Product Data

Format:	=K9
Symbol:	OXT
Locus ID:	5020
Components:	Oxytocin neurophysin 1 gRNA vector 1, Target Sequence: CCACTAGAATATAAGCCCCA Oxytocin neurophysin 1 gRNA vector 2, Target Sequence: CCCTTTTATCTCTGTAGCAC Oxytocin neurophysin 1 gRNA vector 3, Target Sequence: ATGTCCCCTCAGATATCTGC 1 CRISPRa-Enhancer vector 1 CRISPRa scramble vector
RefSeq:	NM_000915
UniProt ID:	P01178
Synonyms:	OT, OT-NPI, OXT-NPI

Disclaimer

Our company designed CRISPRa kits utilizing advanced CRISPRa SAM technology. The effectiveness of the activation may be influenced by various factors, such as nucleosome occupancy status, chromatin structure, and the expression level of the target gene, among others.

All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.