Online Inquiry
Inquiry
Mouse Malat1 Activation Kit
 activation kit by CRISPRa.png)
Description
Malat1 CRISPRa kit - CRISPR gene activation of mouse metastasis associated lung adenocarcinoma transcript 1 (non-coding RNA)
Product Data
| Format: | =K77 |
| Symbol: | Malat1 |
| Locus ID: | 72289 |
| Components: | Malat1 gRNA vector 1, Target Sequence: AGATTTTTCTTGACGTCGTG Malat1 gRNA vector 2, Target Sequence: TTCTTCCTTCACCAAGGTGG Malat1 gRNA vector 3, Target Sequence: AAAGGGACACGTCACTCCAC 1 CRISPRa-Enhancer vector 1 CRISPRa scramble vector |
| RefSeq: | NR_002847 |
Disclaimer
| Our company designed CRISPRa kits utilizing advanced CRISPRa SAM technology. The effectiveness of the activation may be influenced by various factors, such as nucleosome occupancy status, chromatin structure, and the expression level of the target gene, among others. |
All of our services and products are intended for preclinical research use only and cannot be used to diagnose, treat or manage patients.
